Tutorial: My first loculus
This tutorial will guide you through setting up a test instance for Loculus locally, running on a mini Kubernetes cluster. You’ll learn how to install dependencies, deploy Loculus, configure a custom organism, and submit sample data. By the end, you’ll have a Loculus database running on your machine, providing hands-on experience of how things work (but the setup will not be suitable for production use).
Setting up the dependencies
For this example we will be deploying Loculus using its Helm chart, which is deployed on a Kubernetes cluster. There are many different ways of installing Kubernetes, including on managed Cloud Services, but for these purposes we will run Kubernetes on our own machine, using k3d, which relies on Docker.
Docker
First, if we don’t have Docker installed, we need to install it. You should do this by following the instructions on the Docker website.
K3d
Next, we need to install k3d, which is a lightweight wrapper to run K3s (a lightweight Kubernetes distribution) in Docker. To install k3d, run the following command:
curl -s https://raw.githubusercontent.com/k3d-io/k3d/main/install.sh | bash
kubectl
To manage this cluster we will need kubectl, which is the Kubernetes command-line tool. You can do this by running the following commands:
curl -LO "https://dl.k8s.io/release/$(curl -L -s https://dl.k8s.io/release/stable.txt)/bin/linux/amd64/kubectl"chmod +x kubectlsudo mv kubectl /usr/local/bin/
Helm
We deploy Loculus we also need Helm, which is a package manager for Kubernetes. You can do this by running the following commands:
curl -fsSL -o get_helm.sh https://raw.githubusercontent.com/helm/helm/master/scripts/get-helm-3chmod 700 get_helm.sh./get_helm.sh
Our first Loculus instance
Now we need to get the Loculus Helm chart and some helper scripts. You can do this by cloning the Loculus repository:
git clone https://github.com/loculus-project/loculus.gitcd loculus
Creating a cluster
We have a wrapper script which can help with creating a cluster with the correct ports forwarded and to ensure some useful Helm charts get installed. To create a cluster, run the following command:
./deploy.py --verbose cluster
(If you ever need to delete the cluster you can run ./deploy.py cluster --delete
)
Deploying Loculus onto the cluster
Now we can install Loculus using the Helm chart. To do this, run the following command:
helm install loculus ./kubernetes/loculus --set environment=local --set branch=latest --set disableIngest=true --set disableEnaSubmission=true
Checking the status
That command may complete relatively quickly, but it may take a few minutes for the Loculus pods to be fully running. You can check the status of the pods by running the following command:
kubectl get pods
The limiting factor in the pods starting is typically the loculus-keycloak
pod.
Until it starts, other pods will crash because they need it for authentication.
Once it starts, the other pods should follow: initially the website
and backend
, and then lapis
which depends on the backend
pod.
Accessing Loculus
Once the pods are running, you can access Loculus locally - the website will be accessible on port 3000
. If you have been running these commands on your local machine, you can access Loculus by visiting http://127.0.0.1:3000 in your browser. If not you will need to use port forwarding but you can check you can access the page using the following command:
curl http://127.0.0.1:3000
Reconfiguring Loculus
Now that we know we can get Loculus working we can tweak it.
Let’s create a new configuration.
Create a new file (for now we will call it custom_values.yaml
and it can be in your current working directory) with the following content:
name: 'My awesome database'
Now we can “upgrade” the existing Loculus with this configuration:
helm upgrade loculus ./kubernetes/loculus --set environment=local --set branch=latest --set disableIngest=true --set disableEnaSubmission=true -f custom_values.yaml
Again you can check the status of the pods with kubectl get pods
and once they are all running you can check the website again at http://127.0.0.1:3000
.
You should find that the name of the database has changed to “My awesome database”!
Configuring an organism
Loculus ships with some default organisms, but you probably want to overwrite these with your own.
Let’s edit the custom_values.yaml
file to the following:
name: 'Angelovirus DB'organisms: angelovirus: schema: organismName: 'Angelovirus' metadata: - name: country type: string initiallyVisible: true - name: city type: string initiallyVisible: true website: tableColumns: - country - city defaultOrder: descending defaultOrderBy: country preprocessing: - version: 1 image: ghcr.io/loculus-project/preprocessing-nextclade args: - 'prepro' configFile: log_level: DEBUG genes: [] batch_size: 100 referenceGenomes: nucleotideSequences: - name: 'main' sequence: 'NNN' # We are not performing alignment here, so this sequence doesn't matter genes: []createTestAccounts: true
Because we have enabled the createTestAccounts
option, we need to delete the existing keycloak database to ensure that the test users are added.
First we need to run kubectl get pods
to get the name of the keycloak pod, which will be something like loculus-keycloak-database-665b964c6b-gm9t5
(but with the random string at the end being different).
Then we can delete the pod with kubectl delete pod loculus-keycloak-database-[the rest of the pod name]
.
Now we can upgrade the Loculus installation again:
helm upgrade loculus ./kubernetes/loculus --set environment=local --set branch=latest --set disableIngest=true --set disableEnaSubmission=true -f custom_values.yaml
Testing it out with some data
While that’s getting ready, let’s create some data to submit.
First let’s make our sequence file, which we might name sequences.fasta
:
>sample1ATGGGATTTTGGCATATATATACGA>sample2GCAGAGAGAGATACGTATATATATA
Then our metadata file, which we might name metadata.tsv
:
submissionId city country sample1 Paris France sample2 Bogota Colombia
The metadata file must be tab-separated (TSV) — sometimes code editors will try to convert tabs to a number of spaces, causing confusion.
Now we can check everything is running with kubectl get pods
and once it is, we can open up the website at http://localhost:3000
again. Because we enabled the createTestAccounts
option, you should be able to log in with the username testuser
and password testuser
.
You can then go to Submit
. You will be prompted to create a submitting group.
Once you have created a submitting group, you can submit your data. You will need to upload the sequences.fasta
and metadata.tsv
files. You can then select the organism you created earlier (Angelovirus
) and submit the data.
You should find that they appear on your Review page and you can choose to release them. If you wait a minute and then refresh the Search page you should find your sequences have appeared! 🎉 We’ve released the first data for our new database!
Cleaning up
When you are done with experimenting, you can delete the cluster with the following command:
./deploy.py cluster --delete